mcsA [2018-05-18 15:50:52]

modulator of CtsR-dependent repression, McsA activates kinase activity of McsB

Locus: BSU00840

Isoelectric point: 6.62

Molecular weight: 20.88 kDa

Protein length: 185 aa

Gene length: 555 bp

Function: control of CtsR activity

Product: activator of McsB kinase activity

Essential: no

Synonyms: yacH

Genomic Context

Loading

Categories containing this gene/protein

• Information processing → Regulation of gene expression → Transcription factors and their control → Control of transcription factor (other than two-component system)
• Lifestyles → Sporulation → Sporulation proteins → Sporulation proteins/ other
• Lifestyles → Coping with stress → General stress proteins (controlled by SigB)
• Lifestyles → Coping with stress → Heat shock proteins
• Groups of genes → Phosphoproteins → Phosphorylation on an Arg residue

Gene

Coordinates: 101,927 → 102,484

The protein

Modification

• phosphorylated on Arg-169 PubMed

Expression and Regulation

Operons

• Genes: ctsR-mcsA-mcsB-clpC-radA-disA
  Description: PubMed

  Sigma factors

  • SigM: sigma factor, PubMed, in SigM regulon
  • SigA: sigma factor, PubMed, in SigA regulon
  • SigB: sigma factor, PubMed PubMed, in SigB regulon
  • SigF: sigma factor, PubMed, in SigF regulon

  Regulatory mechanism

  • CtsR: repression, PubMed, in CtsR regulon
  • Spx: activation, PubMed, in Spx regulon

  Regulation

  • expressed during germination and spore outgrowth PubMed
  • induction during diamide stress (Spx) PubMed

Biological materials

Mutant

• MGNA-B929 (yacH::erm), available at the NBRP B. subtilis, Japan
• mcsA::aphA3 available from the Gerth lab
• BKE00840 (ΔmcsA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAATCTTTTCACCCGCTTAT, downstream forward: _UP4_GATAGTGAGGAGGAACAGGA
• BKK00840 (ΔmcsA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAATCTTTTCACCCGCTTAT, downstream forward: _UP4_GATAGTGAGGAGGAACAGGA

Expression vector

• for expression, purification in E. coli with N-terminal His-tag, pRSETA available in Gerth lab

Antibody

• available in Gerth lab

References

Loading